Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.189288 |
Chromosome: | chromosome 13 |
Location: | 2059736 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g577300 | GOX13 | Glyoxal oxidase 13; (1 of 20) PTHR32208:SF21 - F10A5.18 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTGTACACGAAGTTGGGACGTCTTGTCA |
Internal bar code: | CGCTTCACACGAGACTCCCCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2610 |
LEAP-Seq percent confirming: | 4.54545 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 42 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACGACCTGAAATGACGGTT |
Suggested primer 2: | CTTCAAACCCCATGAGCAAT |