| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.189298 |
| Chromosome: | chromosome 13 |
| Location: | 3549563 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g588100 | CYN19C,ROC2,CYN5,CYN19-3 | (1 of 1) K09565 - peptidyl-prolyl isomerase F (cyclophilin D) (PPIF); Cyclophilin 19-3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAAACGTCCTTATTCGTGCAGCCAATGC |
| Internal bar code: | TTTCACATGGTGTAGGTTCCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 354 |
| LEAP-Seq percent confirming: | 97.8102 |
| LEAP-Seq n confirming: | 134 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGGGTAGCAACTCCTTTG |
| Suggested primer 2: | TTTGAAACGCTAGGCGACTT |