| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.189315 |
| Chromosome: | chromosome 6 |
| Location: | 1970026 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g263850 | PPT2,TPT2,TPT20 | Triose phosphate/phosphate translocator; (1 of 2) PTHR11132:SF70 - PHOSPHOENOLPYRUVATE/PHOSPHATE TRANSLOCATOR 1, CHLOROPLASTIC | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGCACGCAAGTCGCTGGAATGCAAGCCT |
| Internal bar code: | GGTGTGACTTGGTGTCAAGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 873 |
| LEAP-Seq percent confirming: | 99.8004 |
| LEAP-Seq n confirming: | 500 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAGCCCACAAGACCGAGAG |
| Suggested primer 2: | TGAAGAACTGCGATTGTTGC |