| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.189351 |
| Chromosome: | chromosome 9 |
| Location: | 1302867 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399073 | (1 of 2) PTHR14209:SF9 - ISOAMYL ACETATE-HYDROLYZING ESTERASE 1 HOMOLOG | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGGTCCATGCTGGCAGCTTTGGCGCCAT |
| Internal bar code: | GATTCACCATTCGGGGGCGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 665 |
| LEAP-Seq percent confirming: | 86.8664 |
| LEAP-Seq n confirming: | 377 |
| LEAP-Seq n nonconfirming: | 57 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACTCGATGTCTCTTGCCA |
| Suggested primer 2: | AGGATACCCCATCCTTCACC |