| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.189369 |
| Chromosome: | chromosome 17 |
| Location: | 5850226 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g739752 | FTSHi1,CTAP1,FTSHI1 | (1 of 3) IPR000642//IPR003593//IPR003959//IPR027417 - Peptidase M41 // AAA+ ATPase domain // ATPase, AAA-type, core // P-loop containing nucleoside triphosphate hydrolase; Chloroplast-import FtsH-like ATPase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTTGCACAGCAGGACAGGCACCTAGTAC |
| Internal bar code: | CTCGCCCACCAGATCAGCTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 192 |
| LEAP-Seq percent confirming: | 99.604 |
| LEAP-Seq n confirming: | 503 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCGCTCACCTGTCCTTAG |
| Suggested primer 2: | TACCAGCCCAAACTAAACCG |