| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.189434 |
| Chromosome: | chromosome 14 |
| Location: | 1400763 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g617500 | FAP132,RSP14 | Radial Spoke Protein 14; (1 of 1) PTHR15599:SF1 - RHABDOID TUMOR DELETION REGION PROTEIN 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAACCCCATCCCCAACCCCAAAGACCAC |
| Internal bar code: | AGATAGATACTCAGTTGACGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 829 |
| LEAP-Seq percent confirming: | 90.785 |
| LEAP-Seq n confirming: | 266 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGCAAATCGCGTTCTCTT |
| Suggested primer 2: | TGCACACAGGTAAGCACCTC |