Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.189481 |
Chromosome: | chromosome 3 |
Location: | 2718473 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g161500 | (1 of 1) PTHR23041:SF65 - E3 UBIQUITIN-PROTEIN LIGASE CCNB1IP1 HOMOLOG | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAATCGTGATCTGCATGCATGGCGGAAGGG |
Internal bar code: | CCTGGCCCATGTCCGTTTTCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 937 |
LEAP-Seq percent confirming: | 94.4304 |
LEAP-Seq n confirming: | 746 |
LEAP-Seq n nonconfirming: | 44 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAACAGGAGAACGAGAACC |
Suggested primer 2: | ACAGGCAGGGATATGTCGTC |