Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.189560 |
Chromosome: | chromosome 17 |
Location: | 2800428 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g718850 | RFA1,RPA70A | (1 of 1) PTHR23273//PTHR23273:SF12 - REPLICATION FACTOR A 1, RFA1 // REPLICATION PROTEIN A 70 KDA DNA-BINDING SUBUNIT C-RELATED; Replication protein A, 70 kDa DNA-binding subunit | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACTGACGCGGCCCACCTTGAGGCGGAAG |
Internal bar code: | CCGTGCTTGAAGGCAGGGATCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 976 |
LEAP-Seq percent confirming: | 99.7619 |
LEAP-Seq n confirming: | 419 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATGTTCCGTGGGGCATATT |
Suggested primer 2: | GCCCTGTTGATGCTGGTTAT |