Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.189577 |
Chromosome: | chromosome 6 |
Location: | 6107912 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g289950 | HEN2,HEL28 | (1 of 2) K12598 - ATP-dependent RNA helicase DOB1 (MTR4, SKIV2L2); DEAD/DEAH box helicase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGCCCGGAGCCCTTGTCACATTACGTC |
Internal bar code: | CCCTGCGGCATGACAGACTCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 311 |
LEAP-Seq percent confirming: | 99.3603 |
LEAP-Seq n confirming: | 466 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTACTGCCGACTGATCGTGA |
Suggested primer 2: | TAAGGGGCAGGTTGGTGTAG |