| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.189588 |
| Chromosome: | chromosome 2 |
| Location: | 5273943 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g106500 | DIPP1,IPP2,DIPP | Inositol-phosphate phosphatase; (1 of 1) K07766 - diphosphoinositol-polyphosphate diphosphatase (E3.6.1.52) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCGCGTAAAGCCGTGGACGAGGCCGAGC |
| Internal bar code: | CCCTAGCTCCGCCAACGTCCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 454 |
| LEAP-Seq percent confirming: | 98.7179 |
| LEAP-Seq n confirming: | 154 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTAGTCTTGCCCCGTACC |
| Suggested primer 2: | GCCGTCGATTTACAGGATGT |