| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.189610 |
| Chromosome: | chromosome 6 |
| Location: | 2972861 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g273250 | GPA2,GPAT2 | Glycerol-3-phosphate acyltransferase; (1 of 1) K13506 - glycerol-3-phosphate O-acyltransferase 3/4 (GPAT3_4, AGPAT9, AGPAT6) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACCCAGATCGACCCACAACCCTTTCCCGG |
| Internal bar code: | AGTAACCGCTCATTCGATGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1093 |
| LEAP-Seq percent confirming: | 88.4328 |
| LEAP-Seq n confirming: | 474 |
| LEAP-Seq n nonconfirming: | 62 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGACTTAATGCAGCAGGC |
| Suggested primer 2: | TGGATATCTGGGAAAGCAGG |