Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.189624 |
Chromosome: | chromosome 8 |
Location: | 4617463 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g383400 | SRR11 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 2) K13912 - deleted in malignant brain tumors 1 protein (DMBT1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGGTGGGCCCGGGAGCAGTGCCTTGCG |
Internal bar code: | AGGGCTCGTCCCACAGGTAACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 142 |
LEAP-Seq percent confirming: | 99.7436 |
LEAP-Seq n confirming: | 1167 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATGAAACGCCTTGCTGTAA |
Suggested primer 2: | TTTACAACAGCAGTGCCGAG |