Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.189640 |
Chromosome: | chromosome 13 |
Location: | 3625022 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g588550 | SYP1 | Plasma membrane Qa-SNARE, Syx1/Sso1/Syntaxin1/Syp1 family (Qa.IV); (1 of 1) K08486 - syntaxin 1B/2/3 (STX1B_2_3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCCCGAAGAGCGAAGGCGCAAACAAGCG |
Internal bar code: | GGCATATTATCCGCTTGGCCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 182 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 175 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTATTCACGTCGTTGCTCA |
Suggested primer 2: | TTTCCAGAACATTCATCCCC |