Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.189646 |
Chromosome: | chromosome 10 |
Location: | 2815423 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g439400 | GAT1 | Glutamyl tRNA amidotransferase, subunit A; (1 of 1) K02433 - aspartyl-tRNA(Asn)/glutamyl-tRNA(Gln) amidotransferase subunit A (gatA, QRSL1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGGCCAGCTCCAAGCAGTCCGTGATTCG |
Internal bar code: | CCTGGATTTTTGAGCTGTTTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 617 |
LEAP-Seq percent confirming: | 99.8932 |
LEAP-Seq n confirming: | 935 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGTGGACTGAGCAAGTGA |
Suggested primer 2: | AACAAGGTCATTCCATTCGC |