| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.189650 |
| Chromosome: | chromosome 10 |
| Location: | 2409635 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g435500 | EFT2 | (1 of 1) IPR001816//IPR009060//IPR014039 - Translation elongation factor EFTs/EF1B // UBA-like // Translation elongation factor EFTs/EF1B, dimerisation; elongation factor Ts-like protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCCGCACTGCACCCGCAGGAAGCTCGC |
| Internal bar code: | GTACACCGTACTTAGCATGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 314 |
| LEAP-Seq percent confirming: | 96.4072 |
| LEAP-Seq n confirming: | 322 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCTTTCTTCAGGCTCCAG |
| Suggested primer 2: | GCACAAGAGCGAAGGAAAAC |