| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.189759 |
| Chromosome: | chromosome 6 |
| Location: | 2432824 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g268550 | GTR,CGL121,CSL1 | Cellulose-synthase-like 1; (1 of 1) 2.4.1.32 - Glucomannan 4-beta-mannosyltransferase / Glucomannan-synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACCTATTGGGACCCATGTCATTGGGCTC |
| Internal bar code: | CAGTGTCCCTACCTTACTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1 |
| LEAP-Seq percent confirming: | 99.6283 |
| LEAP-Seq n confirming: | 804 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTTTAGTTTGGGCTGGTA |
| Suggested primer 2: | GCTGCTCCACGTCTATGACA |