| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.189845 |
| Chromosome: | chromosome 10 |
| Location: | 848043 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g423650 | PRPL11 | Chloroplast ribosomal protein L11; (1 of 1) PTHR11661//PTHR11661:SF7 - 60S RIBOSOMAL PROTEIN L12 // 50S RIBOSOMAL PROTEIN L11, CHLOROPLASTIC-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGAGTGGCGGCTATGAAAAGCTGCCACT |
| Internal bar code: | GAATGACTAGCGGTAGTAGTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 205 |
| LEAP-Seq percent confirming: | 99.7524 |
| LEAP-Seq n confirming: | 8862 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTGACTTAAACTGCCCGA |
| Suggested primer 2: | ATAGGCAGTAAGGCCAGGGT |