| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.189860 |
| Chromosome: | chromosome 3 |
| Location: | 4850677 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g179100 | UFD1b | UFD1b homolog; (1 of 1) PF00789//PF03152 - UBX domain (UBX) // Ubiquitin fusion degradation protein UFD1 (UFD1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTGGTCACATTGTCCTCCACAATGCCCG |
| Internal bar code: | TAAAAAGCCGACGTCGATCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 409 |
| LEAP-Seq percent confirming: | 73.7582 |
| LEAP-Seq n confirming: | 787 |
| LEAP-Seq n nonconfirming: | 280 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTATCAATCTCCGCTCCACC |
| Suggested primer 2: | TCCCAATCCCACTCTCACTC |