Insertion junction: LMJ.RY0402.189863_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.189863
Chromosome:chromosome_16
Location:1435412
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre16.g652400 FAL18 Similar to Flagellar Associated Protein FAP183 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CGCGAACGCCACGCCGCGTGTCAACTTCGC
Internal bar code:GCGTGACCCGACACGTATATCC

Confirmation - LEAP-Seq

LEAP-Seq distance:351
LEAP-Seq percent confirming:98.7593
LEAP-Seq n confirming:398
LEAP-Seq n nonconfirming:5
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:ATACCAATACCTCTGCCCCC
Suggested primer 2:GTCCAGGTGTGTGTGTGGAC