| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.189867 |
| Chromosome: | chromosome 9 |
| Location: | 7610135 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g414750 | ELG33 | (1 of 34) 2.4.2.41 - Xylogalacturonan beta-1,3-xylosyltransferase / Xylogalacturonan xylosyltransferase; Exostosin-like glycosyltransferase 33 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTGGTTCAAGCCAGCGGGTTTGTGCAGC |
| Internal bar code: | CCGTGTGACCCTAGGATCCTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 7 |
| LEAP-Seq percent confirming: | 99.3582 |
| LEAP-Seq n confirming: | 774 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCGGATGGAGAAAGTATCC |
| Suggested primer 2: | GTGCGTGTTATCGGGAAAGT |