| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.189878 |
| Chromosome: | chromosome 3 |
| Location: | 3599737 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g168450 | CCT8 | (1 of 1) K09500 - T-complex protein 1 subunit theta (CCT8); T-complex protein 1, theta subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCTCCTTCTGAAGCACTCCACACAGCAC |
| Internal bar code: | GCGTTCAGCCTTACTTATATAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 621 |
| LEAP-Seq percent confirming: | 56.7586 |
| LEAP-Seq n confirming: | 2469 |
| LEAP-Seq n nonconfirming: | 1881 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCTGCTGTTGTTGTTGT |
| Suggested primer 2: | ACAGCATCCTGGACCTGTTC |