Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.189903 |
Chromosome: | chromosome 16 |
Location: | 4021448 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g670300 | PRP39 | (1 of 1) K13217 - pre-mRNA-processing factor 39 (PRPF39, PRP39); Nuclear pre-mRNA splicing factor and U1 snRNP Component | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCAGTGCTGCACGTCTCGTCGTTTCGTG |
Internal bar code: | AGTAGGGGATTAGTGTCGGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 579 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 352 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTGAAGGACTCATGCCCAC |
Suggested primer 2: | CAGTACCCCGCTTACGGTTA |