| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.189907 |
| Chromosome: | chromosome 9 |
| Location: | 7252686 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g412600 | CYG52 | (1 of 1) PF00072//PF00211 - Response regulator receiver domain (Response_reg) // Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc); Adenylate/guanylate cyclase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAAAGGAGGCGACGCATGTGTCACTGAT |
| Internal bar code: | GAACCGTGTATCCTGGGCGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 184 |
| LEAP-Seq percent confirming: | 99.5516 |
| LEAP-Seq n confirming: | 1554 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTGGTGTGCAGTTTGGTG |
| Suggested primer 2: | ACCATCAAGCCAGCATAACC |