| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.189925 |
| Chromosome: | chromosome 3 |
| Location: | 2038942 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g156250 | FAP186,POC13 | Proteome of centriole protein 13; (1 of 5) PF04366 - Las17-binding protein actin regulator (Ysc84) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCTCTACAACCAGCTCAAGGCCTGGCTT |
| Internal bar code: | TACACGTAGGCGAATAATTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 881 |
| LEAP-Seq percent confirming: | 99.7434 |
| LEAP-Seq n confirming: | 1555 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAATAAATAACGCCGTGCCT |
| Suggested primer 2: | CTGCGGTATAGATTTGGGGA |