| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.190419 |
| Chromosome: | chromosome 12 |
| Location: | 8891583 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g544550 | (1 of 38) IPR000719//IPR002290//IPR011009 - Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGAGCACGCGCCGCAAGGTTGCTCGCCC |
| Internal bar code: | GTTTAATAAGACGTAGGCTCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 939 |
| LEAP-Seq percent confirming: | 99.85 |
| LEAP-Seq n confirming: | 3995 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACACACACACACCGT |
| Suggested primer 2: | CTCTTCAGTCTGACCCTCGG |