Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.190428 |
Chromosome: | chromosome 5 |
Location: | 1765905 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g242400 | PGR5 | Proton-gradient related; (1 of 1) PTHR35709:SF1 - PROTEIN PROTON GRADIENT REGULATION 5, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAGACGGCGGCCAATCTGTCCGCCGGTGC |
Internal bar code: | CCCGATATACCCCCTGGCCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 974 |
LEAP-Seq percent confirming: | 99.5392 |
LEAP-Seq n confirming: | 432 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCTTGGCTAGGACTCACTG |
Suggested primer 2: | ATGATGGGCAACAAGGCTAC |