| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.190454 |
| Chromosome: | chromosome_17 |
| Location: | 5613160 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre17.g738050 | AGG4 | Flagellar membrane protein, paralog of AGG2 | sense | intron |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | CTCATCAGCGCATTAGCAATGTGGAAGATG |
| Internal bar code: | GTATTGGCCGTTCTTGTAAACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1011 |
| LEAP-Seq percent confirming: | 99.6424 |
| LEAP-Seq n confirming: | 2229 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTAGTGGCAATCAGGAAGC |
| Suggested primer 2: | ACATGATGGGATGGAACGAT |