| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.190496 |
| Chromosome: | chromosome 4 |
| Location: | 443624 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217922 | (1 of 1) K10601 - E3 ubiquitin-protein ligase synoviolin (SYVN1, HRD1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATTCCACTCCACACCACACCCCTATCTC |
| Internal bar code: | GCAAGGTCGTGAGTTAAGTACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 212 |
| LEAP-Seq percent confirming: | 93.7044 |
| LEAP-Seq n confirming: | 1027 |
| LEAP-Seq n nonconfirming: | 69 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCACGACTTCCTCAGGTT |
| Suggested primer 2: | GGTTGAACAGCCCCATCAT |