| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.190510 |
| Chromosome: | chromosome 10 |
| Location: | 3381479 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g444100 | (1 of 2) PF04564//PF05049 - U-box domain (U-box) // Interferon-inducible GTPase (IIGP) (IIGP) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCAACGGTGGCGTATGTGGCGGTGCAAC |
| Internal bar code: | CATCTTTATGCAGCGTTACGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 814 |
| LEAP-Seq percent confirming: | 99.5185 |
| LEAP-Seq n confirming: | 620 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACCACCTAAAGGCTCCCT |
| Suggested primer 2: | CGACTATGCACTCCCACTCA |