Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.190560 |
Chromosome: | chromosome 5 |
Location: | 3215590 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g239900 | ARS15 | Arylsulfatase; (1 of 19) 3.1.6.1 - Arylsulfatase / Sulfatase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCTCGCGCGGGGCGTGGGCCAGGGGAGG |
Internal bar code: | ACTGCGCGAGTGCTGCCCTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 889 |
LEAP-Seq percent confirming: | 99.2768 |
LEAP-Seq n confirming: | 1510 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATACTGGCATTAGCCGGTTG |
Suggested primer 2: | CACGCAGCAAAGTTCATCAT |