| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.190575 |
| Chromosome: | chromosome 7 |
| Location: | 338732 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g314500 | (1 of 112) 2.7.11.25 - Mitogen-activated protein kinase kinase kinase / MLTK | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCACAATAACTGGGCGTTCCTACGCGCG |
| Internal bar code: | CAGGGGGTCACTAACCTCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 734 |
| LEAP-Seq percent confirming: | 98.6965 |
| LEAP-Seq n confirming: | 3710 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACTATCCATTGCGACCAGC |
| Suggested primer 2: | GGAGCAACCCACTCTATCCA |