| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.190674 |
| Chromosome: | chromosome 11 |
| Location: | 1536786 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467751 | (1 of 4) K06067 - histone deacetylase 1/2 (HDAC1_2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCACTTGAACTGCTCTCGTGTACCGTGCA |
| Internal bar code: | GCAGGGGTAGACTGCACAACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 448 |
| LEAP-Seq percent confirming: | 92.8085 |
| LEAP-Seq n confirming: | 5046 |
| LEAP-Seq n nonconfirming: | 391 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTCCCTTGTTCCGTTGTC |
| Suggested primer 2: | CTACCCACCATTCTGCCCTA |