Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.190711 |
Chromosome: | chromosome 8 |
Location: | 696679 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g360250 | DUR31,DUR4,DUR3B | Urea active transporter; (1 of 3) PTHR11819:SF94 - SODIUM-DEPENDENT MULTIVITAMIN TRANSPORTER-RELATED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACAATGCAAAGGCGACGATACCTGTACG |
Internal bar code: | TAATCCTTGCCCGATCGAGGTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 621 |
LEAP-Seq percent confirming: | 60.0988 |
LEAP-Seq n confirming: | 1095 |
LEAP-Seq n nonconfirming: | 727 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGCGTCCTGTGATCTCTCC |
Suggested primer 2: | TTCATGCAGCCTGTGCTAAC |