| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.190758 |
| Chromosome: | chromosome 1 |
| Location: | 5739283 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g040950 | (1 of 1) PF02816//PF13519 - Alpha-kinase family (Alpha_kinase) // von Willebrand factor type A domain (VWA_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCAATGCTGTGTGTTGGCAGCGTGGACA |
| Internal bar code: | GTAACGGCGCGCGTGGCGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 491 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 102 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGTCCATAGGGTGTTTCC |
| Suggested primer 2: | TTGTACACGTAGCAGGGCAG |