| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.190918 |
| Chromosome: | chromosome 12 |
| Location: | 9374650 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g540351 | SELENOW2,SELW2 | Selenoprotein W2; (1 of 3) IPR011893//IPR012336 - Selenoprotein, Rdx type // Thioredoxin-like fold | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCTGCGCAAGTCGTTATGTGCGGAGGTT |
| Internal bar code: | GAGTGGAGGACTGGCTTTCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 546 |
| LEAP-Seq percent confirming: | 99.2982 |
| LEAP-Seq n confirming: | 283 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAACGCCTCTGATCTCTTC |
| Suggested primer 2: | AGCGAGGTCTGCAGAGGTAA |