| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.190993 |
| Chromosome: | chromosome 17 |
| Location: | 181816 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g697450 | (1 of 1) K15029 - translation initiation factor 3 subunit L (EIF3L) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGGCTACACGCCTCTGGGCGTCTACCT |
| Internal bar code: | GTTCACGCGTAGGCTCAGCATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 99.1736 |
| LEAP-Seq n confirming: | 120 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCCGTCGTACAATCACAC |
| Suggested primer 2: | GCTAGGAGAACATTGCTGGC |