Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.191098 |
Chromosome: | chromosome 1 |
Location: | 1636763 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g008600 | (1 of 1) IPR017993//IPR022751//IPR029044 - Atrophin-1 // Alpha-mannosyltransferase // Nucleotide-diphospho-sugar transferases | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGCGGGACGCCTGCCCCGTCCAGGCGTC |
Internal bar code: | TACGGCCAAGAGACTGCGGACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 533 |
LEAP-Seq percent confirming: | 81.3998 |
LEAP-Seq n confirming: | 3838 |
LEAP-Seq n nonconfirming: | 877 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGTTGAGGTTGAGGAGGGT |
Suggested primer 2: | GCTGTCCGAGTTCAAAGAGG |