| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.191279 |
| Chromosome: | chromosome 8 |
| Location: | 3819937 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g377450 | (1 of 1) PTHR10997:SF9 - IMPORTIN-9 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAAAGGACGGTACAGGATGCAGTGTGGG |
| Internal bar code: | GATGGCAACCACATCACAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 83 |
| LEAP-Seq percent confirming: | 92.6101 |
| LEAP-Seq n confirming: | 589 |
| LEAP-Seq n nonconfirming: | 47 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTTGATGAGGAGGAAGAG |
| Suggested primer 2: | CAACCTGGTGCTAGAGAGCC |