| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.191340 |
| Chromosome: | chromosome 6 |
| Location: | 5416977 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g284050 | TF2F,TAF1 | (1 of 1) K11341 - YEATS domain-containing protein 4 (YEATS4, GAS41, YAF9); Transcription activation factor, putative SWR-C component | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCATTAGCTGCAAGCAGCAAAAGCATGA |
| Internal bar code: | CGCTTCTGTCGCTCCGGACATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 947 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 287 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTCCTGGCAATGGTTTGT |
| Suggested primer 2: | ACGAGGAGCTGGTGTTCAGT |