| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.191477 |
| Chromosome: | chromosome 3 |
| Location: | 3073100 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g164550 | FRA2 | BolA-like domain protein; (1 of 1) PTHR12735:SF27 - BOLA-LIKE PROTEIN 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCAGCCCCTCACCGTGCCCCCGCCACCC |
| Internal bar code: | TGCTAGCGTATTGAGGCGGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 623 |
| LEAP-Seq percent confirming: | 99.0265 |
| LEAP-Seq n confirming: | 5391 |
| LEAP-Seq n nonconfirming: | 53 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACAGCGGATCAAGTGAAG |
| Suggested primer 2: | CATGTCAGAAGGGGAGTGGT |