Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.191505 |
Chromosome: | chromosome 17 |
Location: | 1906053 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g710300 | PHC31 | (1 of 24) IPR003882//IPR024616 - Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 31 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCTGCTTCACCGCGCACGTGGTCCCCTG |
Internal bar code: | GGCCCTGCACTTCACTCTTTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 168 |
LEAP-Seq percent confirming: | 99.1533 |
LEAP-Seq n confirming: | 1171 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCAGGGCGTCAACAATGTA |
Suggested primer 2: | GCCTTGAAAGAAGTTGCCAG |