| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.191567 |
| Chromosome: | chromosome 5 |
| Location: | 2737601 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g236850 | NAT14 | N-acetyltransferase; (1 of 71) IPR016181 - Acyl-CoA N-acyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCACATAGTCAGGCCCGTACGGCGGCAGC |
| Internal bar code: | CCTAACGCGTCCGATGGCGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 906 |
| LEAP-Seq percent confirming: | 99.381 |
| LEAP-Seq n confirming: | 1766 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAGACACGAAAGAGAAGC |
| Suggested primer 2: | TGCTTCCTCATACCGAAACC |