| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.191797 |
| Chromosome: | chromosome 6 |
| Location: | 1608625 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g260700 | XUV1,UAPA6 | (1 of 2) K06901 - putative MFS transporter, AGZA family, xanthine/uracil permease (pbuG); Xanthine/uracil/vitamin C permease-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGTACACACACGGCAGCAGCTTGAAAGA |
| Internal bar code: | TGTTCTCCAGGTACCCTAGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 185 |
| LEAP-Seq percent confirming: | 95.4023 |
| LEAP-Seq n confirming: | 166 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGAGCTTGAAGTGACGAAG |
| Suggested primer 2: | CTTGTGCGCTATGAGGTCAA |