| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.191825 |
| Chromosome: | chromosome 6 |
| Location: | 5540722 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g285150 | APx-R,APX2 | Ascorbate peroxidase-related; (1 of 3) 1.11.1.11 - L-ascorbate peroxidase / Ascorbic acid peroxidase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGAAAGTCATACTGGACTACACCTGGTT |
| Internal bar code: | GGCGCTTGAATAGGACGACGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 570 |
| LEAP-Seq percent confirming: | 99.6769 |
| LEAP-Seq n confirming: | 617 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGCTGGACTGAACTGGCT |
| Suggested primer 2: | CTGTTCTTCCGCGACTTCTC |