| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.191833 |
| Chromosome: | chromosome 16 |
| Location: | 7757434 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g692116 | (1 of 3) PTHR23505:SF12 - MAJOR FACILITATOR PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGGTAGGACCCTCAATACACTTCTGCGC |
| Internal bar code: | GCTCGGCCTCTCGTTACTGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 918 |
| LEAP-Seq percent confirming: | 98.4668 |
| LEAP-Seq n confirming: | 5459 |
| LEAP-Seq n nonconfirming: | 85 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGGGTACTCTACGAGGTG |
| Suggested primer 2: | GCCTGTCAAGAAACCTCTGC |