| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.191920 |
| Chromosome: | chromosome 16 |
| Location: | 6189191 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g675250 | LPL2 | Lipoate-protein ligase B; (1 of 1) PTHR10993:SF11 - PLASTIDIAL LIPOYLTRANSFERASE 2-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCATAACACCGGGTCCGGTGACTTGGTT |
| Internal bar code: | TGCACCATGGTGCAGGCAAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 948 |
| LEAP-Seq percent confirming: | 99.5253 |
| LEAP-Seq n confirming: | 2935 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAGCAGCGTACTTCCTCC |
| Suggested primer 2: | GGATCTACTTTGGGGAAGGC |