| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.191999 |
| Chromosome: | chromosome 3 |
| Location: | 6172024 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g192201 | PHC51 | Pherophorin-chlamydomonas homolog 51; (1 of 71) PF12499 - Pherophorin (DUF3707) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATAGACGAACATAGGTGCGAGGCTGCATC |
| Internal bar code: | AAGGTGCTTACTATCCCTTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 637 |
| LEAP-Seq percent confirming: | 98.4615 |
| LEAP-Seq n confirming: | 192 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGAAGGAAGCGGTTATCTC |
| Suggested primer 2: | CACCATAACCACGTCAGCAC |