| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.192050 |
| Chromosome: | chromosome 5 |
| Location: | 1370966 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g244450 | (1 of 752) IPR027417 - P-loop containing nucleoside triphosphate hydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCATACTGGATCACGCGCAGACAGCGCGT |
| Internal bar code: | TGTTCACCGAGATGCGTAGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 826 |
| LEAP-Seq percent confirming: | 99.6522 |
| LEAP-Seq n confirming: | 2292 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGCCTCTAGCCGTTTGAA |
| Suggested primer 2: | GTTGCATGCCCTTGTACCTT |