| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.192057 |
| Chromosome: | chromosome 11 |
| Location: | 1116337 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467678 | COP6,HKR2 | (1 of 5) IPR001660//IPR013761 - Sterile alpha motif domain // Sterile alpha motif/pointed domain; Histidine cyclase rhodopsin 2 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAAATGATAGAAATTATTTCGGCAGATCA |
| Internal bar code: | ACGGCTGACTCCTCCCGCTCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 867 |
| LEAP-Seq percent confirming: | 99.6178 |
| LEAP-Seq n confirming: | 782 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTCAGGAGGGAACCATCT |
| Suggested primer 2: | GGTACTGTGATGCTTCGGGT |