| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.192298 |
| Chromosome: | chromosome 12 |
| Location: | 9165378 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g542300 | GLYK,GYK1,GLYK1 | Glycerate kinase; (1 of 1) 2.7.1.31 - Glycerate 3-kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAGGTAGTCTGATGACGCCGATGCATGGC |
| Internal bar code: | TAACAGGAGCCCTTCAACCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 734 |
| LEAP-Seq percent confirming: | 80.9661 |
| LEAP-Seq n confirming: | 3939 |
| LEAP-Seq n nonconfirming: | 926 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGCTTGGAGCTGGTCAGT |
| Suggested primer 2: | GGACTGCACTGCAAGTTTGA |